메뉴 건너뛰기

XEDITION

english

For this purpose, rosette leaf tissue was harvested from 4-week-old T4 generation wild-type and CBF transgenic Arabidopsis plants between 10 and 11 am (i.e. 3?C4?h after starting the light period), flash frozen in liquid PD 98059 N2 and stored at ?80???C until RNA extraction. The whole leaves were ground to a fine powder in liquid nitrogen. RNA was extracted with an RNeasy Plant Mini-Kit (Qiagen, Mississauga, ON, Canada), subsequently DNase treated with RNase free DNase (Ambion, Invitrogen, Carlsbad, CA, USA) and used for cDNA synthesis with qScript cDNA Super mix (Quanta Biosciences, VWR, Canada) according to the instructions and components given by the manufacturers. One microgram DNA-free RNA was used as a template for cDNA synthesis. Real-time PCR was performed in 20??L of reaction mixture using PerfecTa SYBR Green Supermix (Quanta Biosciences) in an Applied Biosystems 7300 thermocycler. The reaction mixture containing 50?ng cDNA and 0.2??m of each primer was RAD001 subjected to one cycle of 95???C for 10?min, followed by 40 cycles of 95???C for 15?s and 60???C for 1?min. The following gene-specific primers were used: VrCBF1-H565 (5?? AAGAGGTCAGAGAAGGTTGGAGATG 3??), VrCBF1-C684 (5?? AGCAGGTGGAGTAAGGAGCAAAC 3??), VrCBF4-H19 (5?? ACCCTCACCCGCTCGTATG 3??), VrCBF4-C159 (5?? CCGCGTCTCCCGAAACTT 3??), AtCor15a-Hq (5?? TAAAGGTGACGGCAACATCC) and AtCor15a-Cq (5?? TCGCTTTCTCACCATCTGCT 3??), AtRD29A-Hq (5?? GAACACTCCGGTCTCTCTGC 3??) and AtRD29A-Cq (5?? CAATCTCCGGTACTCCTCCA 3??), AtCor6.6-Hq (5?? TGGGAGTCATAATTGATTCTCGTA 3??) and AtCor6.6-Cq (5?? AAGTTCCAAACGTAGTACATCTAAAGG 3??), AtCor47-Hq (5?? AGCGATGAAGAAGGTGAGGA 3??) and AtCor47-Cq (5?? ACACTGGTACCGGGATGGTA 3??), AtA2ox7-Hq (5?? GCCATCTAACTAGTGGTGAGGAGGT 3??) and AtGA2ox7-Cq (5?? TCCCCACTCTTTCGCAGCT 3??), AtGA2ox3-Hq (5?? GGCACACCCCTGCAATTTT 3??) and AtGA2ox3-Cq (5?? CCAGAAATTTGCTCGACATTCTC 3??), AtRGL3-Hq (5?? ATGGATACAGAGTGGAGGAGAACG 3??) and AtRGL3-Cq (5?? GATGCAGCGATTAGAGGTTTCG 3??), AtFLC-Hq (5?? GAGAATAATCATCATGTGGGAGC buy Sirolimus 3??) and AtFLC-Cq (5?? CAACCGCCGATTTAAGGTGG 3??), AtICE1-Hq (5?? TCCTAAAGGCCAGCAAGCTA 3??) and AtICE1-Cq (5?? CTCTTGTCCTTCTTGGCATTG 3??), AteIF1alphaH769 (5?? CTTCGTCTTCCACTTCAGGATGT 3??) and AteIF1alphaC889 (5?? TCAACCCTGTGGGAGCAAAG 3??). The relative quantification of mRNA levels was determined by normalizing the PCR threshold cycle (CT) number of each gene with that of the EF1?? reference gene. The expression level of each gene in the wild-type control was set to 1. For VrCBF1 and VrCBF4, the amplification on 10?pg plasmid DNA containing VrCBF1 and VrCBF4 coding sequence, respectively was set to 1. Data were analysed by one-way analysis of variance. Statistical differences among the means were determined by the Tukey?CKramer HSD tests (P?<?0.05) using JMP (version 8.0 SAS Institute, Cary, NC, USA) statistical software.
번호 제목 글쓴이 날짜 조회 수
90673 Excessive Traffic SiemSummers 2018.03.14 1
90672 What Everybody Dislikes About Minn Kota Edge and Why RufusHerndon 2018.03.14 0
90671 The Fundamentals of Minn Kota Trolling Motor Power Center Revealed RufusHerndon 2018.03.14 0
90670 The Unusual Details Into Minn Kota Spare Parts List That Many People Don't Know About ClaranceHenderson 2018.03.14 1
90669 Every Thing You Havent Heard About Vorinostat ChaunceyKring 2018.03.14 0
90668 Eskimo Dog Info AnatoleKuhn 2018.03.14 1
90667 Woodwork: Here Is The Whole Fact You Have To Know WillieStafford 2018.03.14 2
90666 Understanding Your Menstrual Cycle and Ovulation Calendar JohnsonFenger 2018.03.14 2
» To Individuals Who Want To Grasp RAD001 But Cannot Get Rolling ChaunceyKring 2018.03.14 2
90664 A Neutral Look At SCH772984 ChaunceyKring 2018.03.14 2
90663 Recommendations For Sorafenib- Guidelines On How To Shoot Sorafenib In The Bat Of An Eye ! AngeGrimes 2018.03.14 10
90662 BKM120 Is Getting Absolutely Free Kick Start... By A Civic Act Ensemble!! AngeGrimes 2018.03.14 2
90661 The Absolute Best Methods Which You Can Use For SCH772984 Explained ChaunceyKring 2018.03.14 2
90660 Extensive Records To BKM120 In Step By Step Order AngeGrimes 2018.03.14 2
90659 Obtain A Panobinostat With Out Putting In A Single Pound AngeGrimes 2018.03.14 3
90658 Something Each Person Needs To Know Regarding SB431542 ChaunceyKring 2018.03.14 4
90657 A Hidden Gem Of Gefitinib AngeGrimes 2018.03.14 2
90656 Crazy Challenges Every IWR-1 Admirer Really Need To Have A Go With AngeGrimes 2018.03.14 0
90655 What You Should Be Made Aware About SB431542 And The Reasons Why ChaunceyKring 2018.03.14 11
90654 Weekly PD0325901 Wrap Up Is Definitely Beginning To Really Feel A Bit Old ChaunceyKring 2018.03.14 0
위로